ID: 1019475372

View in Genome Browser
Species Human (GRCh38)
Location 7:1241649-1241671
Sequence GCGCGGGGAACCACCGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475355_1019475372 8 Left 1019475355 7:1241618-1241640 CCGCCCAGAGGGGGCCCGGACGG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475357_1019475372 5 Left 1019475357 7:1241621-1241643 CCCAGAGGGGGCCCGGACGGAAC No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475361_1019475372 -7 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475359_1019475372 -6 Left 1019475359 7:1241632-1241654 CCCGGACGGAACCCCCCGCGCGG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475346_1019475372 24 Left 1019475346 7:1241602-1241624 CCCTCTGCCCGGGGCGCCGCCCA No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475351_1019475372 17 Left 1019475351 7:1241609-1241631 CCCGGGGCGCCGCCCAGAGGGGG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475347_1019475372 23 Left 1019475347 7:1241603-1241625 CCTCTGCCCGGGGCGCCGCCCAG No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475358_1019475372 4 Left 1019475358 7:1241622-1241644 CCAGAGGGGGCCCGGACGGAACC No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475345_1019475372 25 Left 1019475345 7:1241601-1241623 CCCCTCTGCCCGGGGCGCCGCCC No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data
1019475353_1019475372 16 Left 1019475353 7:1241610-1241632 CCGGGGCGCCGCCCAGAGGGGGC No data
Right 1019475372 7:1241649-1241671 GCGCGGGGAACCACCGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475372 Original CRISPR GCGCGGGGAACCACCGGGCC GGG Intergenic