ID: 1019475373

View in Genome Browser
Species Human (GRCh38)
Location 7:1241658-1241680
Sequence ACCACCGGGCCGGGCAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475355_1019475373 17 Left 1019475355 7:1241618-1241640 CCGCCCAGAGGGGGCCCGGACGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475364_1019475373 -8 Left 1019475364 7:1241643-1241665 CCCCCCGCGCGGGGAACCACCGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475351_1019475373 26 Left 1019475351 7:1241609-1241631 CCCGGGGCGCCGCCCAGAGGGGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475357_1019475373 14 Left 1019475357 7:1241621-1241643 CCCAGAGGGGGCCCGGACGGAAC No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475366_1019475373 -9 Left 1019475366 7:1241644-1241666 CCCCCGCGCGGGGAACCACCGGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475361_1019475373 2 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475359_1019475373 3 Left 1019475359 7:1241632-1241654 CCCGGACGGAACCCCCCGCGCGG No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475353_1019475373 25 Left 1019475353 7:1241610-1241632 CCGGGGCGCCGCCCAGAGGGGGC No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475358_1019475373 13 Left 1019475358 7:1241622-1241644 CCAGAGGGGGCCCGGACGGAACC No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data
1019475368_1019475373 -10 Left 1019475368 7:1241645-1241667 CCCCGCGCGGGGAACCACCGGGC No data
Right 1019475373 7:1241658-1241680 ACCACCGGGCCGGGCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475373 Original CRISPR ACCACCGGGCCGGGCAGAGC TGG Intergenic