ID: 1019475377

View in Genome Browser
Species Human (GRCh38)
Location 7:1241669-1241691
Sequence GGGCAGAGCTGGCGTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475364_1019475377 3 Left 1019475364 7:1241643-1241665 CCCCCCGCGCGGGGAACCACCGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475357_1019475377 25 Left 1019475357 7:1241621-1241643 CCCAGAGGGGGCCCGGACGGAAC No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475359_1019475377 14 Left 1019475359 7:1241632-1241654 CCCGGACGGAACCCCCCGCGCGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475358_1019475377 24 Left 1019475358 7:1241622-1241644 CCAGAGGGGGCCCGGACGGAACC No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475361_1019475377 13 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475369_1019475377 0 Left 1019475369 7:1241646-1241668 CCCGCGCGGGGAACCACCGGGCC No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475366_1019475377 2 Left 1019475366 7:1241644-1241666 CCCCCGCGCGGGGAACCACCGGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475355_1019475377 28 Left 1019475355 7:1241618-1241640 CCGCCCAGAGGGGGCCCGGACGG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475370_1019475377 -1 Left 1019475370 7:1241647-1241669 CCGCGCGGGGAACCACCGGGCCG No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data
1019475368_1019475377 1 Left 1019475368 7:1241645-1241667 CCCCGCGCGGGGAACCACCGGGC No data
Right 1019475377 7:1241669-1241691 GGGCAGAGCTGGCGTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475377 Original CRISPR GGGCAGAGCTGGCGTGAGTA TGG Intergenic