ID: 1019475381

View in Genome Browser
Species Human (GRCh38)
Location 7:1241675-1241697
Sequence AGCTGGCGTGAGTATGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475366_1019475381 8 Left 1019475366 7:1241644-1241666 CCCCCGCGCGGGGAACCACCGGG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475375_1019475381 -10 Left 1019475375 7:1241662-1241684 CCGGGCCGGGCAGAGCTGGCGTG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475364_1019475381 9 Left 1019475364 7:1241643-1241665 CCCCCCGCGCGGGGAACCACCGG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475358_1019475381 30 Left 1019475358 7:1241622-1241644 CCAGAGGGGGCCCGGACGGAACC No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475359_1019475381 20 Left 1019475359 7:1241632-1241654 CCCGGACGGAACCCCCCGCGCGG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475374_1019475381 -7 Left 1019475374 7:1241659-1241681 CCACCGGGCCGGGCAGAGCTGGC No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475368_1019475381 7 Left 1019475368 7:1241645-1241667 CCCCGCGCGGGGAACCACCGGGC No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475370_1019475381 5 Left 1019475370 7:1241647-1241669 CCGCGCGGGGAACCACCGGGCCG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475361_1019475381 19 Left 1019475361 7:1241633-1241655 CCGGACGGAACCCCCCGCGCGGG No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data
1019475369_1019475381 6 Left 1019475369 7:1241646-1241668 CCCGCGCGGGGAACCACCGGGCC No data
Right 1019475381 7:1241675-1241697 AGCTGGCGTGAGTATGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475381 Original CRISPR AGCTGGCGTGAGTATGGAGG GGG Intergenic