ID: 1019475534

View in Genome Browser
Species Human (GRCh38)
Location 7:1242403-1242425
Sequence CCCCACAGGCTGCGCCTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019475527_1019475534 -4 Left 1019475527 7:1242384-1242406 CCGAGACGCTGGGCCCGGCCCCC No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475522_1019475534 5 Left 1019475522 7:1242375-1242397 CCGCCCCGGCCGAGACGCTGGGC No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475516_1019475534 22 Left 1019475516 7:1242358-1242380 CCGGTGGTCCAGCTCGCCCGCCC No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475523_1019475534 2 Left 1019475523 7:1242378-1242400 CCCCGGCCGAGACGCTGGGCCCG No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475524_1019475534 1 Left 1019475524 7:1242379-1242401 CCCGGCCGAGACGCTGGGCCCGG No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475526_1019475534 0 Left 1019475526 7:1242380-1242402 CCGGCCGAGACGCTGGGCCCGGC No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475518_1019475534 14 Left 1019475518 7:1242366-1242388 CCAGCTCGCCCGCCCCGGCCGAG No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data
1019475520_1019475534 6 Left 1019475520 7:1242374-1242396 CCCGCCCCGGCCGAGACGCTGGG No data
Right 1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019475534 Original CRISPR CCCCACAGGCTGCGCCTGAC GGG Intergenic
No off target data available for this crispr