ID: 1019477908

View in Genome Browser
Species Human (GRCh38)
Location 7:1252824-1252846
Sequence CCGCCTAGGCCCAGACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477908_1019477925 29 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477925 7:1252876-1252898 GGGCCACCGATCATTCAGAGGGG No data
1019477908_1019477918 8 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477918 7:1252855-1252877 AGGGCCCCGCAGAGCTAACGGGG No data
1019477908_1019477916 6 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477916 7:1252853-1252875 TCAGGGCCCCGCAGAGCTAACGG No data
1019477908_1019477924 28 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477908_1019477923 27 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477923 7:1252874-1252896 GGGGGCCACCGATCATTCAGAGG No data
1019477908_1019477919 9 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477919 7:1252856-1252878 GGGCCCCGCAGAGCTAACGGGGG No data
1019477908_1019477917 7 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477917 7:1252854-1252876 CAGGGCCCCGCAGAGCTAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477908 Original CRISPR CCGCCTAGGCCCAGACCTGC GGG (reversed) Intergenic