ID: 1019477914

View in Genome Browser
Species Human (GRCh38)
Location 7:1252838-1252860
Sequence GGCCCTGAGGAAGCCCGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477914_1019477924 14 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477914_1019477925 15 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477925 7:1252876-1252898 GGGCCACCGATCATTCAGAGGGG No data
1019477914_1019477917 -7 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477917 7:1252854-1252876 CAGGGCCCCGCAGAGCTAACGGG No data
1019477914_1019477923 13 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477923 7:1252874-1252896 GGGGGCCACCGATCATTCAGAGG No data
1019477914_1019477916 -8 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477916 7:1252853-1252875 TCAGGGCCCCGCAGAGCTAACGG No data
1019477914_1019477918 -6 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477918 7:1252855-1252877 AGGGCCCCGCAGAGCTAACGGGG No data
1019477914_1019477919 -5 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477919 7:1252856-1252878 GGGCCCCGCAGAGCTAACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477914 Original CRISPR GGCCCTGAGGAAGCCCGCCT AGG (reversed) Intergenic