ID: 1019477915

View in Genome Browser
Species Human (GRCh38)
Location 7:1252851-1252873
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477915_1019477924 1 Left 1019477915 7:1252851-1252873 CCTCAGGGCCCCGCAGAGCTAAC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477915_1019477925 2 Left 1019477915 7:1252851-1252873 CCTCAGGGCCCCGCAGAGCTAAC No data
Right 1019477925 7:1252876-1252898 GGGCCACCGATCATTCAGAGGGG No data
1019477915_1019477928 28 Left 1019477915 7:1252851-1252873 CCTCAGGGCCCCGCAGAGCTAAC No data
Right 1019477928 7:1252902-1252924 TAGTTCAATGAGCCACGTAGAGG No data
1019477915_1019477923 0 Left 1019477915 7:1252851-1252873 CCTCAGGGCCCCGCAGAGCTAAC No data
Right 1019477923 7:1252874-1252896 GGGGGCCACCGATCATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477915 Original CRISPR GTTAGCTCTGCGGGGCCCTG AGG (reversed) Intergenic