ID: 1019477922

View in Genome Browser
Species Human (GRCh38)
Location 7:1252861-1252883
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477922_1019477925 -8 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477925 7:1252876-1252898 GGGCCACCGATCATTCAGAGGGG No data
1019477922_1019477928 18 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477928 7:1252902-1252924 TAGTTCAATGAGCCACGTAGAGG No data
1019477922_1019477929 21 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477922_1019477930 22 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477930 7:1252906-1252928 TCAATGAGCCACGTAGAGGAGGG No data
1019477922_1019477935 30 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG No data
1019477922_1019477932 26 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477932 7:1252910-1252932 TGAGCCACGTAGAGGAGGGCGGG No data
1019477922_1019477933 27 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477933 7:1252911-1252933 GAGCCACGTAGAGGAGGGCGGGG No data
1019477922_1019477924 -9 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477922_1019477923 -10 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477923 7:1252874-1252896 GGGGGCCACCGATCATTCAGAGG No data
1019477922_1019477931 25 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477931 7:1252909-1252931 ATGAGCCACGTAGAGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477922 Original CRISPR GGTGGCCCCCGTTAGCTCTG CGG (reversed) Intergenic