ID: 1019477924

View in Genome Browser
Species Human (GRCh38)
Location 7:1252875-1252897
Sequence GGGGCCACCGATCATTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477920_1019477924 -7 Left 1019477920 7:1252859-1252881 CCCCGCAGAGCTAACGGGGGCCA No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477908_1019477924 28 Left 1019477908 7:1252824-1252846 CCCGCAGGTCTGGGCCTAGGCGG No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477915_1019477924 1 Left 1019477915 7:1252851-1252873 CCTCAGGGCCCCGCAGAGCTAAC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477910_1019477924 27 Left 1019477910 7:1252825-1252847 CCGCAGGTCTGGGCCTAGGCGGG No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477922_1019477924 -9 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477921_1019477924 -8 Left 1019477921 7:1252860-1252882 CCCGCAGAGCTAACGGGGGCCAC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data
1019477914_1019477924 14 Left 1019477914 7:1252838-1252860 CCTAGGCGGGCTTCCTCAGGGCC No data
Right 1019477924 7:1252875-1252897 GGGGCCACCGATCATTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477924 Original CRISPR GGGGCCACCGATCATTCAGA GGG Intergenic