ID: 1019477927

View in Genome Browser
Species Human (GRCh38)
Location 7:1252882-1252904
Sequence CTAAAGCCCCTCTGAATGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477927_1019477938 20 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477938 7:1252925-1252947 AGGGCGGGGCGGCCTGGCCAGGG No data
1019477927_1019477931 4 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477931 7:1252909-1252931 ATGAGCCACGTAGAGGAGGGCGG No data
1019477927_1019477932 5 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477932 7:1252910-1252932 TGAGCCACGTAGAGGAGGGCGGG No data
1019477927_1019477936 14 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477936 7:1252919-1252941 TAGAGGAGGGCGGGGCGGCCTGG No data
1019477927_1019477929 0 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477927_1019477933 6 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477933 7:1252911-1252933 GAGCCACGTAGAGGAGGGCGGGG No data
1019477927_1019477935 9 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG No data
1019477927_1019477937 19 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477937 7:1252924-1252946 GAGGGCGGGGCGGCCTGGCCAGG No data
1019477927_1019477928 -3 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477928 7:1252902-1252924 TAGTTCAATGAGCCACGTAGAGG No data
1019477927_1019477930 1 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477930 7:1252906-1252928 TCAATGAGCCACGTAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477927 Original CRISPR CTAAAGCCCCTCTGAATGAT CGG (reversed) Intergenic