ID: 1019477929

View in Genome Browser
Species Human (GRCh38)
Location 7:1252905-1252927
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477922_1019477929 21 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477927_1019477929 0 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477921_1019477929 22 Left 1019477921 7:1252860-1252882 CCCGCAGAGCTAACGGGGGCCAC No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477920_1019477929 23 Left 1019477920 7:1252859-1252881 CCCCGCAGAGCTAACGGGGGCCA No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data
1019477926_1019477929 3 Left 1019477926 7:1252879-1252901 CCACCGATCATTCAGAGGGGCTT No data
Right 1019477929 7:1252905-1252927 TTCAATGAGCCACGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477929 Original CRISPR TTCAATGAGCCACGTAGAGG AGG Intergenic