ID: 1019477935

View in Genome Browser
Species Human (GRCh38)
Location 7:1252914-1252936
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477926_1019477935 12 Left 1019477926 7:1252879-1252901 CCACCGATCATTCAGAGGGGCTT No data
Right 1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG No data
1019477927_1019477935 9 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG No data
1019477922_1019477935 30 Left 1019477922 7:1252861-1252883 CCGCAGAGCTAACGGGGGCCACC No data
Right 1019477935 7:1252914-1252936 CCACGTAGAGGAGGGCGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477935 Original CRISPR CCACGTAGAGGAGGGCGGGG CGG Intergenic