ID: 1019477938

View in Genome Browser
Species Human (GRCh38)
Location 7:1252925-1252947
Sequence AGGGCGGGGCGGCCTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019477927_1019477938 20 Left 1019477927 7:1252882-1252904 CCGATCATTCAGAGGGGCTTTAG No data
Right 1019477938 7:1252925-1252947 AGGGCGGGGCGGCCTGGCCAGGG No data
1019477926_1019477938 23 Left 1019477926 7:1252879-1252901 CCACCGATCATTCAGAGGGGCTT No data
Right 1019477938 7:1252925-1252947 AGGGCGGGGCGGCCTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019477938 Original CRISPR AGGGCGGGGCGGCCTGGCCA GGG Intergenic