ID: 1019479416

View in Genome Browser
Species Human (GRCh38)
Location 7:1259749-1259771
Sequence GAGTGTGAGCAGAGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019479400_1019479416 8 Left 1019479400 7:1259718-1259740 CCTGCCATCCGACTCCCCCGAGG No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479406_1019479416 -7 Left 1019479406 7:1259733-1259755 CCCCGAGGGAGACCCCGAGTGTG No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479404_1019479416 0 Left 1019479404 7:1259726-1259748 CCGACTCCCCCGAGGGAGACCCC No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479403_1019479416 4 Left 1019479403 7:1259722-1259744 CCATCCGACTCCCCCGAGGGAGA No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479408_1019479416 -9 Left 1019479408 7:1259735-1259757 CCGAGGGAGACCCCGAGTGTGAG No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479407_1019479416 -8 Left 1019479407 7:1259734-1259756 CCCGAGGGAGACCCCGAGTGTGA No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479398_1019479416 21 Left 1019479398 7:1259705-1259727 CCTAGAGGGTCCTCCTGCCATCC No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479405_1019479416 -6 Left 1019479405 7:1259732-1259754 CCCCCGAGGGAGACCCCGAGTGT No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data
1019479399_1019479416 11 Left 1019479399 7:1259715-1259737 CCTCCTGCCATCCGACTCCCCCG No data
Right 1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019479416 Original CRISPR GAGTGTGAGCAGAGGGAGGG TGG Intergenic
No off target data available for this crispr