ID: 1019480553

View in Genome Browser
Species Human (GRCh38)
Location 7:1264783-1264805
Sequence AGGGGCGCAAGGCTGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480553_1019480567 16 Left 1019480553 7:1264783-1264805 CCTGCCTGCAGCCTTGCGCCCCT No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
1019480553_1019480568 17 Left 1019480553 7:1264783-1264805 CCTGCCTGCAGCCTTGCGCCCCT No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480553_1019480565 15 Left 1019480553 7:1264783-1264805 CCTGCCTGCAGCCTTGCGCCCCT No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480553 Original CRISPR AGGGGCGCAAGGCTGCAGGC AGG (reversed) Intergenic