ID: 1019480554

View in Genome Browser
Species Human (GRCh38)
Location 7:1264787-1264809
Sequence GGGCAGGGGCGCAAGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480554_1019480568 13 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480554_1019480565 11 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
1019480554_1019480572 30 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480554_1019480567 12 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480554 Original CRISPR GGGCAGGGGCGCAAGGCTGC AGG (reversed) Intergenic