ID: 1019480556

View in Genome Browser
Species Human (GRCh38)
Location 7:1264794-1264816
Sequence TTCCAGGGGGCAGGGGCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480556_1019480568 6 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480556_1019480565 4 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
1019480556_1019480572 23 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480556_1019480567 5 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480556 Original CRISPR TTCCAGGGGGCAGGGGCGCA AGG (reversed) Intergenic