ID: 1019480557

View in Genome Browser
Species Human (GRCh38)
Location 7:1264801-1264823
Sequence GGGAGAGTTCCAGGGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480557_1019480565 -3 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
1019480557_1019480568 -1 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480557_1019480574 27 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480557_1019480567 -2 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
1019480557_1019480572 16 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480557 Original CRISPR GGGAGAGTTCCAGGGGGCAG GGG (reversed) Intergenic