ID: 1019480560

View in Genome Browser
Species Human (GRCh38)
Location 7:1264807-1264829
Sequence GCTGCTGGGAGAGTTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480560_1019480572 10 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480560_1019480575 26 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480575 7:1264856-1264878 CAGATGGAGAAACTGAGGCTAGG No data
1019480560_1019480565 -9 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
1019480560_1019480568 -7 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480560_1019480567 -8 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
1019480560_1019480576 30 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480576 7:1264860-1264882 TGGAGAAACTGAGGCTAGGAAGG No data
1019480560_1019480574 21 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480560 Original CRISPR GCTGCTGGGAGAGTTCCAGG GGG (reversed) Intergenic