ID: 1019480561

View in Genome Browser
Species Human (GRCh38)
Location 7:1264808-1264830
Sequence GGCTGCTGGGAGAGTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480561_1019480576 29 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480576 7:1264860-1264882 TGGAGAAACTGAGGCTAGGAAGG No data
1019480561_1019480577 30 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480561_1019480568 -8 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480561_1019480574 20 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480561_1019480575 25 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480575 7:1264856-1264878 CAGATGGAGAAACTGAGGCTAGG No data
1019480561_1019480565 -10 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480565 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
1019480561_1019480567 -9 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480567 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
1019480561_1019480572 9 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480561 Original CRISPR GGCTGCTGGGAGAGTTCCAG GGG (reversed) Intergenic