ID: 1019480566

View in Genome Browser
Species Human (GRCh38)
Location 7:1264822-1264844
Sequence CCCATCTCTCTTGGGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480566_1019480576 15 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480576 7:1264860-1264882 TGGAGAAACTGAGGCTAGGAAGG No data
1019480566_1019480574 6 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480566_1019480577 16 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480566_1019480575 11 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480575 7:1264856-1264878 CAGATGGAGAAACTGAGGCTAGG No data
1019480566_1019480572 -5 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480566_1019480578 21 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480566 Original CRISPR CCCATCTCTCTTGGGGCTGC TGG (reversed) Intergenic