ID: 1019480568

View in Genome Browser
Species Human (GRCh38)
Location 7:1264823-1264845
Sequence CAGCAGCCCCAAGAGAGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480552_1019480568 21 Left 1019480552 7:1264779-1264801 CCTGCCTGCCTGCAGCCTTGCGC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480559_1019480568 -3 Left 1019480559 7:1264803-1264825 CCTGCCCCCTGGAACTCTCCCAG No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480556_1019480568 6 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480551_1019480568 22 Left 1019480551 7:1264778-1264800 CCCTGCCTGCCTGCAGCCTTGCG No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480563_1019480568 -10 Left 1019480563 7:1264810-1264832 CCTGGAACTCTCCCAGCAGCCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480560_1019480568 -7 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480558_1019480568 -2 Left 1019480558 7:1264802-1264824 CCCTGCCCCCTGGAACTCTCCCA No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480553_1019480568 17 Left 1019480553 7:1264783-1264805 CCTGCCTGCAGCCTTGCGCCCCT No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480557_1019480568 -1 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480554_1019480568 13 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480562_1019480568 -9 Left 1019480562 7:1264809-1264831 CCCTGGAACTCTCCCAGCAGCCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480550_1019480568 30 Left 1019480550 7:1264770-1264792 CCAGCTCACCCTGCCTGCCTGCA No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data
1019480561_1019480568 -8 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480568 7:1264823-1264845 CAGCAGCCCCAAGAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480568 Original CRISPR CAGCAGCCCCAAGAGAGATG GGG Intergenic