ID: 1019480569

View in Genome Browser
Species Human (GRCh38)
Location 7:1264829-1264851
Sequence TGGCAGCCCCATCTCTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480569_1019480574 -1 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480569_1019480575 4 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480575 7:1264856-1264878 CAGATGGAGAAACTGAGGCTAGG No data
1019480569_1019480576 8 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480576 7:1264860-1264882 TGGAGAAACTGAGGCTAGGAAGG No data
1019480569_1019480577 9 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480569_1019480578 14 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480569 Original CRISPR TGGCAGCCCCATCTCTCTTG GGG (reversed) Intergenic