ID: 1019480570

View in Genome Browser
Species Human (GRCh38)
Location 7:1264830-1264852
Sequence ATGGCAGCCCCATCTCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480570_1019480577 8 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480570_1019480574 -2 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480570_1019480578 13 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480570_1019480575 3 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480575 7:1264856-1264878 CAGATGGAGAAACTGAGGCTAGG No data
1019480570_1019480576 7 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480576 7:1264860-1264882 TGGAGAAACTGAGGCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480570 Original CRISPR ATGGCAGCCCCATCTCTCTT GGG (reversed) Intergenic