ID: 1019480572

View in Genome Browser
Species Human (GRCh38)
Location 7:1264840-1264862
Sequence ATGGGGCTGCCATTTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480562_1019480572 8 Left 1019480562 7:1264809-1264831 CCCTGGAACTCTCCCAGCAGCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480563_1019480572 7 Left 1019480563 7:1264810-1264832 CCTGGAACTCTCCCAGCAGCCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480566_1019480572 -5 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480559_1019480572 14 Left 1019480559 7:1264803-1264825 CCTGCCCCCTGGAACTCTCCCAG No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480564_1019480572 -4 Left 1019480564 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480556_1019480572 23 Left 1019480556 7:1264794-1264816 CCTTGCGCCCCTGCCCCCTGGAA No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480554_1019480572 30 Left 1019480554 7:1264787-1264809 CCTGCAGCCTTGCGCCCCTGCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480560_1019480572 10 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480561_1019480572 9 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480557_1019480572 16 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data
1019480558_1019480572 15 Left 1019480558 7:1264802-1264824 CCCTGCCCCCTGGAACTCTCCCA No data
Right 1019480572 7:1264840-1264862 ATGGGGCTGCCATTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480572 Original CRISPR ATGGGGCTGCCATTTGCAGA TGG Intergenic