ID: 1019480574

View in Genome Browser
Species Human (GRCh38)
Location 7:1264851-1264873
Sequence ATTTGCAGATGGAGAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480571_1019480574 -3 Left 1019480571 7:1264831-1264853 CCAAGAGAGATGGGGCTGCCATT No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480570_1019480574 -2 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480562_1019480574 19 Left 1019480562 7:1264809-1264831 CCCTGGAACTCTCCCAGCAGCCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480566_1019480574 6 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480557_1019480574 27 Left 1019480557 7:1264801-1264823 CCCCTGCCCCCTGGAACTCTCCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480560_1019480574 21 Left 1019480560 7:1264807-1264829 CCCCCTGGAACTCTCCCAGCAGC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480561_1019480574 20 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480558_1019480574 26 Left 1019480558 7:1264802-1264824 CCCTGCCCCCTGGAACTCTCCCA No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480564_1019480574 7 Left 1019480564 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480559_1019480574 25 Left 1019480559 7:1264803-1264825 CCTGCCCCCTGGAACTCTCCCAG No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480569_1019480574 -1 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data
1019480563_1019480574 18 Left 1019480563 7:1264810-1264832 CCTGGAACTCTCCCAGCAGCCCC No data
Right 1019480574 7:1264851-1264873 ATTTGCAGATGGAGAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480574 Original CRISPR ATTTGCAGATGGAGAAACTG AGG Intergenic