ID: 1019480577

View in Genome Browser
Species Human (GRCh38)
Location 7:1264861-1264883
Sequence GGAGAAACTGAGGCTAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480561_1019480577 30 Left 1019480561 7:1264808-1264830 CCCCTGGAACTCTCCCAGCAGCC No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480562_1019480577 29 Left 1019480562 7:1264809-1264831 CCCTGGAACTCTCCCAGCAGCCC No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480566_1019480577 16 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480570_1019480577 8 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480564_1019480577 17 Left 1019480564 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480571_1019480577 7 Left 1019480571 7:1264831-1264853 CCAAGAGAGATGGGGCTGCCATT No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480569_1019480577 9 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data
1019480563_1019480577 28 Left 1019480563 7:1264810-1264832 CCTGGAACTCTCCCAGCAGCCCC No data
Right 1019480577 7:1264861-1264883 GGAGAAACTGAGGCTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480577 Original CRISPR GGAGAAACTGAGGCTAGGAA GGG Intergenic