ID: 1019480578

View in Genome Browser
Species Human (GRCh38)
Location 7:1264866-1264888
Sequence AACTGAGGCTAGGAAGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019480571_1019480578 12 Left 1019480571 7:1264831-1264853 CCAAGAGAGATGGGGCTGCCATT No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480564_1019480578 22 Left 1019480564 7:1264821-1264843 CCCAGCAGCCCCAAGAGAGATGG No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480569_1019480578 14 Left 1019480569 7:1264829-1264851 CCCCAAGAGAGATGGGGCTGCCA No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480570_1019480578 13 Left 1019480570 7:1264830-1264852 CCCAAGAGAGATGGGGCTGCCAT No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480573_1019480578 -6 Left 1019480573 7:1264849-1264871 CCATTTGCAGATGGAGAAACTGA No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data
1019480566_1019480578 21 Left 1019480566 7:1264822-1264844 CCAGCAGCCCCAAGAGAGATGGG No data
Right 1019480578 7:1264866-1264888 AACTGAGGCTAGGAAGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019480578 Original CRISPR AACTGAGGCTAGGAAGGGTT AGG Intergenic