ID: 1019482927

View in Genome Browser
Species Human (GRCh38)
Location 7:1274664-1274686
Sequence GCTTCCGGGTGCATCTGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019482927_1019482946 29 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482946 7:1274716-1274738 GCTCTGTGGTGTGTGTGGGGGGG No data
1019482927_1019482945 28 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482945 7:1274715-1274737 CGCTCTGTGGTGTGTGTGGGGGG No data
1019482927_1019482944 27 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482944 7:1274714-1274736 CCGCTCTGTGGTGTGTGTGGGGG No data
1019482927_1019482938 15 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482938 7:1274702-1274724 GGGCCTTAGACGCCGCTCTGTGG No data
1019482927_1019482942 26 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482942 7:1274713-1274735 GCCGCTCTGTGGTGTGTGTGGGG No data
1019482927_1019482940 24 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482940 7:1274711-1274733 ACGCCGCTCTGTGGTGTGTGTGG No data
1019482927_1019482933 -6 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482933 7:1274681-1274703 GGAAGCGCGGCAGCCCAGCCTGG No data
1019482927_1019482941 25 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482941 7:1274712-1274734 CGCCGCTCTGTGGTGTGTGTGGG No data
1019482927_1019482934 -5 Left 1019482927 7:1274664-1274686 CCCCGTCAGATGCACCCGGAAGC No data
Right 1019482934 7:1274682-1274704 GAAGCGCGGCAGCCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019482927 Original CRISPR GCTTCCGGGTGCATCTGACG GGG (reversed) Intergenic
No off target data available for this crispr