ID: 1019485289

View in Genome Browser
Species Human (GRCh38)
Location 7:1286354-1286376
Sequence CAACGTGGCCGGAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019485272_1019485289 30 Left 1019485272 7:1286301-1286323 CCCTGAGGTGGGAGGGGCCGGGC No data
Right 1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG No data
1019485273_1019485289 29 Left 1019485273 7:1286302-1286324 CCTGAGGTGGGAGGGGCCGGGCG No data
Right 1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG No data
1019485280_1019485289 5 Left 1019485280 7:1286326-1286348 CCTCAGGCTCAGCGAGGGGCTGA No data
Right 1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG No data
1019485276_1019485289 13 Left 1019485276 7:1286318-1286340 CCGGGCGGCCTCAGGCTCAGCGA No data
Right 1019485289 7:1286354-1286376 CAACGTGGCCGGAGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019485289 Original CRISPR CAACGTGGCCGGAGTGGAGT GGG Intergenic
No off target data available for this crispr