ID: 1019486035

View in Genome Browser
Species Human (GRCh38)
Location 7:1289576-1289598
Sequence CTGTGGGTTTGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019486035_1019486043 0 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486043 7:1289599-1289621 ATGACTTTTCCTATCAAAACGGG No data
1019486035_1019486047 17 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486035_1019486046 16 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486046 7:1289615-1289637 AAACGGGCAATAAAGCCGGCCGG No data
1019486035_1019486045 12 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486045 7:1289611-1289633 ATCAAAACGGGCAATAAAGCCGG No data
1019486035_1019486042 -1 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019486035 Original CRISPR CTGTGGGTTTGGAGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr