ID: 1019486042

View in Genome Browser
Species Human (GRCh38)
Location 7:1289598-1289620
Sequence GATGACTTTTCCTATCAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019486037_1019486042 -8 Left 1019486037 7:1289583-1289605 CCCTCCAAACCCACAGATGACTT No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486033_1019486042 9 Left 1019486033 7:1289566-1289588 CCCGGGGGCTCCTTCCACCCTCC No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486038_1019486042 -9 Left 1019486038 7:1289584-1289606 CCTCCAAACCCACAGATGACTTT No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486031_1019486042 11 Left 1019486031 7:1289564-1289586 CCCCCGGGGGCTCCTTCCACCCT No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486027_1019486042 21 Left 1019486027 7:1289554-1289576 CCACCTCTCCCCCCCGGGGGCTC No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486030_1019486042 12 Left 1019486030 7:1289563-1289585 CCCCCCGGGGGCTCCTTCCACCC No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486036_1019486042 -5 Left 1019486036 7:1289580-1289602 CCACCCTCCAAACCCACAGATGA No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486029_1019486042 13 Left 1019486029 7:1289562-1289584 CCCCCCCGGGGGCTCCTTCCACC No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486034_1019486042 8 Left 1019486034 7:1289567-1289589 CCGGGGGCTCCTTCCACCCTCCA No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486028_1019486042 18 Left 1019486028 7:1289557-1289579 CCTCTCCCCCCCGGGGGCTCCTT No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486035_1019486042 -1 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486026_1019486042 22 Left 1019486026 7:1289553-1289575 CCCACCTCTCCCCCCCGGGGGCT No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data
1019486032_1019486042 10 Left 1019486032 7:1289565-1289587 CCCCGGGGGCTCCTTCCACCCTC No data
Right 1019486042 7:1289598-1289620 GATGACTTTTCCTATCAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019486042 Original CRISPR GATGACTTTTCCTATCAAAA CGG Intergenic
No off target data available for this crispr