ID: 1019486047

View in Genome Browser
Species Human (GRCh38)
Location 7:1289616-1289638
Sequence AACGGGCAATAAAGCCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019486039_1019486047 6 Left 1019486039 7:1289587-1289609 CCAAACCCACAGATGACTTTTCC No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486036_1019486047 13 Left 1019486036 7:1289580-1289602 CCACCCTCCAAACCCACAGATGA No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486035_1019486047 17 Left 1019486035 7:1289576-1289598 CCTTCCACCCTCCAAACCCACAG No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486034_1019486047 26 Left 1019486034 7:1289567-1289589 CCGGGGGCTCCTTCCACCCTCCA No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486030_1019486047 30 Left 1019486030 7:1289563-1289585 CCCCCCGGGGGCTCCTTCCACCC No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486032_1019486047 28 Left 1019486032 7:1289565-1289587 CCCCGGGGGCTCCTTCCACCCTC No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486041_1019486047 0 Left 1019486041 7:1289593-1289615 CCACAGATGACTTTTCCTATCAA No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486038_1019486047 9 Left 1019486038 7:1289584-1289606 CCTCCAAACCCACAGATGACTTT No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486040_1019486047 1 Left 1019486040 7:1289592-1289614 CCCACAGATGACTTTTCCTATCA No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486033_1019486047 27 Left 1019486033 7:1289566-1289588 CCCGGGGGCTCCTTCCACCCTCC No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486031_1019486047 29 Left 1019486031 7:1289564-1289586 CCCCCGGGGGCTCCTTCCACCCT No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data
1019486037_1019486047 10 Left 1019486037 7:1289583-1289605 CCCTCCAAACCCACAGATGACTT No data
Right 1019486047 7:1289616-1289638 AACGGGCAATAAAGCCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019486047 Original CRISPR AACGGGCAATAAAGCCGGCC GGG Intergenic
No off target data available for this crispr