ID: 1019486983

View in Genome Browser
Species Human (GRCh38)
Location 7:1293992-1294014
Sequence CCCCGGGCGCCGAGTTCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019486975_1019486983 12 Left 1019486975 7:1293957-1293979 CCTCGCCGTCATAAACCCGCGTG No data
Right 1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG No data
1019486978_1019486983 -4 Left 1019486978 7:1293973-1293995 CCGCGTGCACCGCGTCACTCCCC No data
Right 1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG No data
1019486976_1019486983 7 Left 1019486976 7:1293962-1293984 CCGTCATAAACCCGCGTGCACCG No data
Right 1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG No data
1019486977_1019486983 -3 Left 1019486977 7:1293972-1293994 CCCGCGTGCACCGCGTCACTCCC No data
Right 1019486983 7:1293992-1294014 CCCCGGGCGCCGAGTTCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019486983 Original CRISPR CCCCGGGCGCCGAGTTCCGC CGG Intergenic
No off target data available for this crispr