ID: 1019487660

View in Genome Browser
Species Human (GRCh38)
Location 7:1296654-1296676
Sequence CCCGGGCCTCGGGGGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019487638_1019487660 30 Left 1019487638 7:1296601-1296623 CCTCATCTGCGGGGCCTGGGAAG No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data
1019487641_1019487660 16 Left 1019487641 7:1296615-1296637 CCTGGGAAGGAGCTGGCCCCCGA No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data
1019487649_1019487660 -3 Left 1019487649 7:1296634-1296656 CCGAGATGGGCCACCTGGGTCCC No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data
1019487648_1019487660 -2 Left 1019487648 7:1296633-1296655 CCCGAGATGGGCCACCTGGGTCC No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data
1019487647_1019487660 -1 Left 1019487647 7:1296632-1296654 CCCCGAGATGGGCCACCTGGGTC No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data
1019487646_1019487660 0 Left 1019487646 7:1296631-1296653 CCCCCGAGATGGGCCACCTGGGT No data
Right 1019487660 7:1296654-1296676 CCCGGGCCTCGGGGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019487660 Original CRISPR CCCGGGCCTCGGGGGTCCCT GGG Intergenic