ID: 1019488527

View in Genome Browser
Species Human (GRCh38)
Location 7:1300486-1300508
Sequence CCTCGGTGTCTCCACACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019488527_1019488535 9 Left 1019488527 7:1300486-1300508 CCCTGAGTGTGGAGACACCGAGG No data
Right 1019488535 7:1300518-1300540 GGCTGCCCTGCGCACAGCACAGG No data
1019488527_1019488539 19 Left 1019488527 7:1300486-1300508 CCCTGAGTGTGGAGACACCGAGG No data
Right 1019488539 7:1300528-1300550 CGCACAGCACAGGGCACACCAGG No data
1019488527_1019488536 10 Left 1019488527 7:1300486-1300508 CCCTGAGTGTGGAGACACCGAGG No data
Right 1019488536 7:1300519-1300541 GCTGCCCTGCGCACAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019488527 Original CRISPR CCTCGGTGTCTCCACACTCA GGG (reversed) Intergenic
No off target data available for this crispr