ID: 1019488662

View in Genome Browser
Species Human (GRCh38)
Location 7:1301004-1301026
Sequence TCTAGGGAGCCGCAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019488662_1019488673 26 Left 1019488662 7:1301004-1301026 CCTCTGCCCTGCGGCTCCCTAGA No data
Right 1019488673 7:1301053-1301075 ATTTACAGATGAGCAAACTGAGG No data
1019488662_1019488667 -10 Left 1019488662 7:1301004-1301026 CCTCTGCCCTGCGGCTCCCTAGA No data
Right 1019488667 7:1301017-1301039 GCTCCCTAGAGGCCCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019488662 Original CRISPR TCTAGGGAGCCGCAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr