ID: 1019488763

View in Genome Browser
Species Human (GRCh38)
Location 7:1301390-1301412
Sequence ATAAGGTTTCTGGACAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019488747_1019488763 25 Left 1019488747 7:1301342-1301364 CCCCAAGCCCTTCCTGCGTGGTC No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488751_1019488763 18 Left 1019488751 7:1301349-1301371 CCCTTCCTGCGTGGTCAGGCACA No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488746_1019488763 26 Left 1019488746 7:1301341-1301363 CCCCCAAGCCCTTCCTGCGTGGT No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488753_1019488763 13 Left 1019488753 7:1301354-1301376 CCTGCGTGGTCAGGCACAGATCA No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488752_1019488763 17 Left 1019488752 7:1301350-1301372 CCTTCCTGCGTGGTCAGGCACAG No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488748_1019488763 24 Left 1019488748 7:1301343-1301365 CCCAAGCCCTTCCTGCGTGGTCA No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data
1019488749_1019488763 23 Left 1019488749 7:1301344-1301366 CCAAGCCCTTCCTGCGTGGTCAG No data
Right 1019488763 7:1301390-1301412 ATAAGGTTTCTGGACAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019488763 Original CRISPR ATAAGGTTTCTGGACAACTG GGG Intergenic
No off target data available for this crispr