ID: 1019490582

View in Genome Browser
Species Human (GRCh38)
Location 7:1311417-1311439
Sequence GAGGACACACGCGGGCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019490572_1019490582 26 Left 1019490572 7:1311368-1311390 CCACGGGTGGGGCTGAAGTGGGC No data
Right 1019490582 7:1311417-1311439 GAGGACACACGCGGGCTTCTGGG No data
1019490570_1019490582 27 Left 1019490570 7:1311367-1311389 CCCACGGGTGGGGCTGAAGTGGG No data
Right 1019490582 7:1311417-1311439 GAGGACACACGCGGGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019490582 Original CRISPR GAGGACACACGCGGGCTTCT GGG Intergenic
No off target data available for this crispr