ID: 1019490768

View in Genome Browser
Species Human (GRCh38)
Location 7:1312231-1312253
Sequence GCTCCCGGGGGGCCACATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019490760_1019490768 -1 Left 1019490760 7:1312209-1312231 CCCGCGGAATCACGGCTAAGCCG No data
Right 1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG No data
1019490761_1019490768 -2 Left 1019490761 7:1312210-1312232 CCGCGGAATCACGGCTAAGCCGC No data
Right 1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019490768 Original CRISPR GCTCCCGGGGGGCCACATGC CGG Intergenic
No off target data available for this crispr