ID: 1019493510

View in Genome Browser
Species Human (GRCh38)
Location 7:1325751-1325773
Sequence GGTACCAGGGCCCCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019493498_1019493510 20 Left 1019493498 7:1325708-1325730 CCTTTCTTGGGGCTGCAAGGTCC No data
Right 1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG No data
1019493503_1019493510 -1 Left 1019493503 7:1325729-1325751 CCATGGTGTGGCCCAGGGCGTGG No data
Right 1019493510 7:1325751-1325773 GGTACCAGGGCCCCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019493510 Original CRISPR GGTACCAGGGCCCCCCATGC AGG Intergenic
No off target data available for this crispr