ID: 1019493771

View in Genome Browser
Species Human (GRCh38)
Location 7:1326795-1326817
Sequence CAGAGCACAGGGCAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019493763_1019493771 13 Left 1019493763 7:1326759-1326781 CCTTTCACAGCCCCACTCGAGGC No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493764_1019493771 3 Left 1019493764 7:1326769-1326791 CCCCACTCGAGGCTCCTGAGCTT No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493760_1019493771 22 Left 1019493760 7:1326750-1326772 CCAGATCCTCCTTTCACAGCCCC No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493757_1019493771 27 Left 1019493757 7:1326745-1326767 CCTCCCCAGATCCTCCTTTCACA No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493759_1019493771 23 Left 1019493759 7:1326749-1326771 CCCAGATCCTCCTTTCACAGCCC No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493766_1019493771 1 Left 1019493766 7:1326771-1326793 CCACTCGAGGCTCCTGAGCTTCT No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493765_1019493771 2 Left 1019493765 7:1326770-1326792 CCCACTCGAGGCTCCTGAGCTTC No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493761_1019493771 16 Left 1019493761 7:1326756-1326778 CCTCCTTTCACAGCCCCACTCGA No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data
1019493758_1019493771 24 Left 1019493758 7:1326748-1326770 CCCCAGATCCTCCTTTCACAGCC No data
Right 1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019493771 Original CRISPR CAGAGCACAGGGCAGGCTGC AGG Intergenic
No off target data available for this crispr