ID: 1019496803

View in Genome Browser
Species Human (GRCh38)
Location 7:1344582-1344604
Sequence AACCATATCAGGCAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019496797_1019496803 30 Left 1019496797 7:1344529-1344551 CCAACATTGGGGATTACAATTTT No data
Right 1019496803 7:1344582-1344604 AACCATATCAGGCAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019496803 Original CRISPR AACCATATCAGGCAGCTGCC AGG Intergenic
No off target data available for this crispr