ID: 1019499659

View in Genome Browser
Species Human (GRCh38)
Location 7:1358614-1358636
Sequence GTCTCCCGGGCCTGGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019499659_1019499673 26 Left 1019499659 7:1358614-1358636 CCGTCCCCCCAGGCCCGGGAGAC No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499659_1019499668 1 Left 1019499659 7:1358614-1358636 CCGTCCCCCCAGGCCCGGGAGAC No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019499659 Original CRISPR GTCTCCCGGGCCTGGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr