ID: 1019499668

View in Genome Browser
Species Human (GRCh38)
Location 7:1358638-1358660
Sequence TCACAGCGCCAGTGACCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019499664_1019499668 -7 Left 1019499664 7:1358622-1358644 CCAGGCCCGGGAGACCTCACAGC No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data
1019499662_1019499668 -5 Left 1019499662 7:1358620-1358642 CCCCAGGCCCGGGAGACCTCACA No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data
1019499660_1019499668 -3 Left 1019499660 7:1358618-1358640 CCCCCCAGGCCCGGGAGACCTCA No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data
1019499663_1019499668 -6 Left 1019499663 7:1358621-1358643 CCCAGGCCCGGGAGACCTCACAG No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data
1019499659_1019499668 1 Left 1019499659 7:1358614-1358636 CCGTCCCCCCAGGCCCGGGAGAC No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data
1019499661_1019499668 -4 Left 1019499661 7:1358619-1358641 CCCCCAGGCCCGGGAGACCTCAC No data
Right 1019499668 7:1358638-1358660 TCACAGCGCCAGTGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019499668 Original CRISPR TCACAGCGCCAGTGACCCAC AGG Intergenic
No off target data available for this crispr