ID: 1019499673

View in Genome Browser
Species Human (GRCh38)
Location 7:1358663-1358685
Sequence AGATCATTCCCGAGTTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019499666_1019499673 12 Left 1019499666 7:1358628-1358650 CCGGGAGACCTCACAGCGCCAGT No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499661_1019499673 21 Left 1019499661 7:1358619-1358641 CCCCCAGGCCCGGGAGACCTCAC No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499659_1019499673 26 Left 1019499659 7:1358614-1358636 CCGTCCCCCCAGGCCCGGGAGAC No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499663_1019499673 19 Left 1019499663 7:1358621-1358643 CCCAGGCCCGGGAGACCTCACAG No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499669_1019499673 -6 Left 1019499669 7:1358646-1358668 CCAGTGACCCACAGGCCAGATCA No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499665_1019499673 13 Left 1019499665 7:1358627-1358649 CCCGGGAGACCTCACAGCGCCAG No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499662_1019499673 20 Left 1019499662 7:1358620-1358642 CCCCAGGCCCGGGAGACCTCACA No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499667_1019499673 4 Left 1019499667 7:1358636-1358658 CCTCACAGCGCCAGTGACCCACA No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499664_1019499673 18 Left 1019499664 7:1358622-1358644 CCAGGCCCGGGAGACCTCACAGC No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data
1019499660_1019499673 22 Left 1019499660 7:1358618-1358640 CCCCCCAGGCCCGGGAGACCTCA No data
Right 1019499673 7:1358663-1358685 AGATCATTCCCGAGTTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019499673 Original CRISPR AGATCATTCCCGAGTTAAAC AGG Intergenic
No off target data available for this crispr