ID: 1019501203

View in Genome Browser
Species Human (GRCh38)
Location 7:1365535-1365557
Sequence AGCTGAAGACCCTGGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019501203_1019501211 20 Left 1019501203 7:1365535-1365557 CCTGCTCACCAGGGTCTTCAGCT No data
Right 1019501211 7:1365578-1365600 CATCCCTTCCTGAATATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019501203 Original CRISPR AGCTGAAGACCCTGGTGAGC AGG (reversed) Intergenic
No off target data available for this crispr