ID: 1019502090

View in Genome Browser
Species Human (GRCh38)
Location 7:1369513-1369535
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502090_1019502098 1 Left 1019502090 7:1369513-1369535 CCAGCCCACCTAGGACCTTGGCC No data
Right 1019502098 7:1369537-1369559 ACCACGGACCCTGCCCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502090 Original CRISPR GGCCAAGGTCCTAGGTGGGC TGG (reversed) Intergenic
No off target data available for this crispr