ID: 1019502206

View in Genome Browser
Species Human (GRCh38)
Location 7:1369927-1369949
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502206_1019502209 -9 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502209 7:1369941-1369963 ATGGGATTGCTCCCCCAAAAGGG No data
1019502206_1019502221 21 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502221 7:1369971-1369993 TGTGTGGGATATGAGATGGCGGG No data
1019502206_1019502215 5 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502215 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
1019502206_1019502210 -8 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502210 7:1369942-1369964 TGGGATTGCTCCCCCAAAAGGGG No data
1019502206_1019502216 6 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502216 7:1369956-1369978 CAAAAGGGGCCCTGCTGTGTGGG No data
1019502206_1019502208 -10 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502208 7:1369940-1369962 AATGGGATTGCTCCCCCAAAAGG No data
1019502206_1019502220 20 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502220 7:1369970-1369992 CTGTGTGGGATATGAGATGGCGG No data
1019502206_1019502222 26 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502206_1019502219 17 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502219 7:1369967-1369989 CTGCTGTGTGGGATATGAGATGG No data
1019502206_1019502224 30 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502206_1019502223 29 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502206 Original CRISPR CAATCCCATTACAGGCTGCC TGG (reversed) Intergenic